The things we touch and those we conceive are as improbable as our senses and our reason; we are sure only in our verbal universe, manageable at will—and ineffectual. Being is mute and the mind is garrulous. This is called knowing.

I use Gentoo btw
Marlb gold
Deterritorialized flows of desire ( ...the absolute within a circuit )
C, Shell and Python codifying
Writing
Absolute Zero ( An ineffectual refusal to be born .)
Femboys
Christ
Young Sheldon ( Metal flexes beneath vatgrown skin .)
Pornosophical philotheology

Mediocrity ( Cogito ergo sum )
Pre-Kantian Dogmatism , the Spectacle totally dogmatic ( except for Spinoza my beloved )
Stability as a biovirus ( ATGACTTATCCACGGTACATTCAGT cellular DNA )
Sanctity as transcendence

Love, loving loving love, loves ex nihilo. Hesed.